Stem-loop sequence ahy-MIR156c

Accession MI0015334
Description Arachis hypogaea miR156c stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
----------  --u    --     uauaa   u           -          -a     g   u   c      
          cc   cgaa  gagau     aug ugacagaagag agagagcaca  cccga aaa ggu aaaga 
          ||   ||||  |||||     ||| ||||||||||| ||||||||||  ||||| ||| ||| |||| a
          gg   guuu  uucua     uac acugucuucuc ucucucgugu  ggguu uuu cca uuucu 
uucuagauau  uau    au     -uuuc   u           a          ga     g   -   u      
Get sequence

Mature sequence ahy-miR156c

Accession MIMAT0016320
Sequence

21 - 

uugacagaagagagagagcac

 - 41

Get sequence
Evidence experimental; Solexa [1]

References

1
PMID:20047695 "Deep sequencing identifies novel and conserved microRNAs in peanuts (Arachis hypogaea L.)" Zhao CZ, Xia H, Frazier TP, Yao YY, Bi YP, Li AQ, Li MJ, Li CS, Zhang BH, Wang XJ BMC Plant Biol. 10:3(2010).