|
miRBase |
|
Stem-loop sequence sja-mir-3503 |
|||||
| Accession | MI0015327 | ||||
| Description | Schistosoma japonicum miR-3503 stem-loop | ||||
| Stem-loop |
- c acg uu aa gugacugguaag ggaauccaggac cg uc c |||||||||||| |||||||||||| || || cauugaucguuc cuuuagguuuug gu ag c a a --a uu au |
||||
| Genome context |
|
||||
Mature sequence sja-miR-3503 |
|
| Accession | MIMAT0016312 |
| Sequence |
11 - agcggaauccaggacacgcguuu - 33 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|