|
miRBase |
|
Stem-loop sequence sja-mir-3500 |
|||||
| Accession | MI0015324 | ||||
| Description | Schistosoma japonicum miR-3500 stem-loop | ||||
| Stem-loop |
uucg aucg a ug uu caggaaaggag guggu gauug auug u ||||||||||| ||||| ||||| |||| g gucuuuuuuuc uacua uuaau uaau c auga cuug a gu ua |
||||
| Genome context |
|
||||
Mature sequence sja-miR-3500 |
|
| Accession | MIMAT0016309 |
| Sequence |
11 - aggagaucggugguagauugu - 31 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|