|
miRBase |
|
Stem-loop sequence sja-mir-3488 |
|||||||
| Accession | MI0015312 | ||||||
| Description | Schistosoma japonicum miR-3488 stem-loop | ||||||
| Stem-loop |
u -aa - u a aau g ggug ugac gauuga g uuau ggcgc c |||| |||| |||||| | |||| ||||| ccgc auug uugauu c gaug ucgug a g gag g - - gcc c |
||||||
| Genome context |
|
||||||
Mature sequence sja-miR-3488 |
|
| Accession | MIMAT0016297 |
| Sequence |
39 - gcuccgguagcuuaguuggu - 58 |
| Evidence | experimental; Solexa [1] |
References |
|
| 1 |
PMID:20161724
"An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum"
PLoS Negl Trop Dis. 4:e596(2010).
|