Stem-loop sequence sja-mir-2d

AccessionMI0015302 (change log)
DescriptionSchistosoma japonicum miR-2d stem-loop
Gene family MIPF0000049; mir-2
Literature search

7 open access papers mention sja-mir-2d
(21 sentences)

Stem-loop
   -   cc           ----  u          u   gg   cc     
5'  cga  aguucgucauc    ca ggauugugau uuc  acu  augu 
    |||  |||||||||||    || |||||||||| |||  |||  ||| u
3'  gcu  uuaagcagugg    gu ccugacacua aag  uga  uacu 
   u   --           auuc  -          u   --   au     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01011791.1: 3049-3137 [+]
intergenic
Clustered miRNAs
< 10kb from sja-mir-2d
sja-mir-71bCABF01011791.1: 2817-2909 [+]
sja-mir-2dCABF01011791.1: 3049-3137 [+]
sja-mir-2cCABF01011791.1: 3159-3237 [+]
Database links

Mature sequence sja-miR-2d-5p

Accession MIMAT0016278
Sequence

11 - 

gucauccauggauugugauuuu

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-2d-3p

Accession MIMAT0016279
Sequence

58 - 

uaucacaguccugcuuagguga

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).