Stem-loop sequence sja-mir-2c

AccessionMI0015301 (change log)
DescriptionSchistosoma japonicum miR-2c stem-loop
Gene family MIPF0000049; mir-2
Literature search

7 open access papers mention sja-mir-2c
(22 sentences)

Stem-loop
   -   a    caa      --uu  a          auuga 
5'  uuc ggcg   cccuug    cg cugugaugug     a
    ||| ||||   ||||||    || ||||||||||     a
3'  aag cugc   gggaau    gc gacacuauac     u
   a   -    uuc      ucgu  c          ccgau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01011791.1: 3159-3237 [+]
intergenic
Clustered miRNAs
< 10kb from sja-mir-2c
sja-mir-71bCABF01011791.1: 2817-2909 [+]
sja-mir-2dCABF01011791.1: 3049-3137 [+]
sja-mir-2cCABF01011791.1: 3159-3237 [+]
Database links

Mature sequence sja-miR-2c-5p

Accession MIMAT0016276
Sequence

11 - 

acccuuguucgacugugaugug

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-2c-3p

Accession MIMAT0016277
Sequence

48 - 

uaucacagccgugcuuaagggc

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).