Stem-loop sequence sja-mir-277

AccessionMI0015296 (change log)
DescriptionSchistosoma japonicum miR-277 stem-loop
Literature search

4 open access papers mention sja-mir-277
(23 sentences)

Stem-loop
   auaannnnnnnnnnauauuguaaaugcauuuucuggcccguaacuaa    -caau     -uc    u    gaua 
5'                                                gaca     gaaca   cuua cuuu    g
                                                  ||||     |||||   |||| ||||    u
3'                                                cugu     uuugu   gaau gaaa    u
   -------------ggguagugacuuuucuuuccuguagauaauguaa    ucugu     uuu    u    auuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence sja-miR-277

Accession MIMAT0016269
Sequence

21 - 

uaaaugcauuuucuggcccg

 - 40

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).