Stem-loop sequence sja-mir-71b

AccessionMI0015291 (change log)
DescriptionSchistosoma japonicum miR-71b stem-loop
Gene family MIPF0000278; mir-71
Literature search

17 open access papers mention sja-mir-71b
(112 sentences)

Stem-loop
   -  -  uu    u         g    g    a    uau g   ugu 
5'  cc gu  gcug gaaagacuu agua ugag cgcu   a cgu   u
    || ||  |||| ||||||||| |||| |||| ||||   | |||    
3'  gg ca  cggc cuuucugaa ucau acuc gcgg   u gcg   g
   c  u  cu    c         -    -    c    -cu g   ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01011791.1: 2817-2909 [+]
intergenic
Clustered miRNAs
< 10kb from sja-mir-71b
sja-mir-71bCABF01011791.1: 2817-2909 [+]
sja-mir-2dCABF01011791.1: 3049-3137 [+]
sja-mir-2cCABF01011791.1: 3159-3237 [+]
Database links

Mature sequence sja-miR-71b-5p

Accession MIMAT0016260
Sequence

11 - 

ugaaagacuugaguagugagacg

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-71b-3p

Accession MIMAT0016261
Sequence

63 - 

ccucauacuaagucuuucccg

 - 83

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).