Stem-loop sequence sja-mir-10

AccessionMI0015287 (change log)
DescriptionSchistosoma japonicum miR-10 stem-loop
Gene family MIPF0000033; mir-10
Literature search

8 open access papers mention sja-mir-10
(22 sentences)

Stem-loop
   --  uc     -gaa  c       c        g  gcc 
5'   cc  aguau    cc uguagac cgaguuug au   g
     ||  |||||    || ||||||| |||||||| ||    
3'   gg  ucaua    gg auaucug gcuuaaac ua   u
   aa  uu     gaaa  a       a        g  gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01007487.1: 6178-6256 [+]
intergenic
Database links

Mature sequence sja-miR-10-5p

Accession MIMAT0016253
Sequence

11 - 

aacccuguagacccgaguuugg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence sja-miR-10-3p

Accession MIMAT0016254
Sequence

47 - 

aaauucgagucuauaaggaaaga

 - 69

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).