Stem-loop sequence sja-mir-1

AccessionMI0015282 (change log)
DescriptionSchistosoma japonicum miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

11 open access papers mention sja-mir-1
(60 sentences)

Stem-loop
   c      -       a         -   ----      agua  g 
5'  aaaagu aguauuc uuauaugga aug    uggcga    ug u
    |||||| ||||||| ||||||||| |||    ||||||    || c
3'  uuuuca uuaugag aguauauuu uac    aucguu    ac u
   -      c       a         c   uaag      ---g  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15177v1; GCA_000151775.1) Overlapping transcripts
CABF01001061.1: 9-93 [+]
intergenic
Database links

Mature sequence sja-miR-1

Accession MIMAT0016244
Sequence

21 - 

uggaauguggcgaaguaugguc

 - 42

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20161724 "An "in-depth" description of the small non-coding RNA population of Schistosoma japonicum schistosomulum" Wang Z, Xue X, Sun J, Luo R, Xu X, Jiang Y, Zhang Q, Pan W PLoS Negl Trop Dis. 4:e596(2010).