Dead miRNA entry

miRNA accession:
MI0015257
miRNA ID:
ppy-mir-1302-2
Forward to:
MI0015256
Comment:
The 5 annotated mir-1302 sequences map to just 4 loci in the P_pygmaeus_2.0.2 genome assembly. The entries are rationalised and merged.

Previous miRNA entry

Stem-loop sequence ppy-mir-1302-2

AccessionMI0015257 (change log)
DescriptionPongo pygmaeus miR-1302-2 stem-loop
Gene family MIPF0000456; mir-1302
Stem-loop
   -      ccag       -                  g      --  c     c   a              
5'  ggaugc    uuaguuu gaauuuuagauaaacaac aauaau  uu uuagc uaa uaugucccaagcu 
    ||||||    ||||||| |||||||||||||||||| ||||||  || ||||| ||| |||||||||||| u
3'  uuuacg    aauuaaa cuuagagucuauuuguug uuauua  aa aaucg auu auacaggguuuga 
   u      ----       a                  g      ca  a     u   c              
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ppy-miR-1302

Accession MIMAT0016222
Sequence

73 - 

uugggacauacuuaugcuaaa

 - 93

Get sequence
Evidence not experimental

References

1