Stem-loop sequence ppy-mir-1302-1

AccessionMI0015256 (change log)
DescriptionPongo pygmaeus miR-1302-1 stem-loop
Gene family MIPF0000456; mir-1302
Stem-loop
   -      ccag       -                  g      --  c     c   a              
5'  ggaugc    uuaguuu gaauuuuagauaaacaac aauaau  uu uuagc uaa uaugucccaagcu 
    ||||||    ||||||| |||||||||||||||||| ||||||  || ||||| ||| |||||||||||| u
3'  uuuacg    aauuaaa cuuagagucuauuuguug uuauua  aa aaucg auu auacaggguuuga 
   u      ----       a                  g      ca  a     u   c              
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 21154807-21154943 [+]
intergenic
Database links

Mature sequence ppy-miR-1302

Accession MIMAT0016222
Sequence

73 - 

uugggacauacuuaugcuaaa

 - 93

Get sequence
Evidence not experimental

References

1