Stem-loop sequence ppy-mir-1295

AccessionMI0015250 (change log)
DescriptionPongo pygmaeus miR-1295 stem-loop
Gene family MIPF0000676; mir-1295
Stem-loop
   --                   c        u   g aau 
5'   aggacauuuuacccagauc guggccua uca a   g
     ||||||||||||||||||| |||||||| ||| |   u
3'   uccuguaaagugggucuag cgccggau agu u   g
   cc                   a        u   g ccg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 80027080-80027158 [+]
intergenic
Database links

Mature sequence ppy-miR-1295

Accession MIMAT0016216
Sequence

49 - 

uuaggccgcagaucuggguga

 - 69

Get sequence
Evidence not experimental

References

1