Stem-loop sequence ppy-mir-1277

AccessionMI0015234 (change log)
DescriptionPongo pygmaeus miR-1277 stem-loop
Gene family MIPF0001937; mir-1277
Stem-loop
   --   uc     u            g        ug au 
5'   acc  ccaaa auauauauauau uacguaug  u  a
     |||  ||||| |||||||||||| ||||||||  |   
3'   ugg  gguuu uauguauauaua augcauau  a  u
   uu   gu     u            g        gu aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 117330117-117330194 [+]
intergenic
Database links

Mature sequence ppy-miR-1277

Accession MIMAT0016200
Sequence

47 - 

uacguagauauauauguauuuu

 - 68

Get sequence
Evidence not experimental

References

1