Stem-loop sequence ppy-mir-1268

AccessionMI0015226 (change log)
DescriptionPongo pygmaeus miR-1268 stem-loop
Gene family MIPF0000946; mir-1268
Stem-loop
   uagccgggcgugguggugggcgccugugg      c 
5'                              ucccag u
                                ||||||  
3'                              aggguu a
   ----------------------gagucgg      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 21471313-21471364 [+]
intergenic
chr1: 198147444-198147495 [+]
intergenic
chr4: 166112169-166112220 [+]
intergenic
chr7: 127104773-127104824 [-]
intergenic
NW_002937925.1: 7344-7395 [+]
intergenic
Database links

Mature sequence ppy-miR-1268

Accession MIMAT0016192
Sequence

5 - 

cgggcgugguggugggcg

 - 22

Get sequence
Evidence not experimental

References

1