Stem-loop sequence ppy-mir-1263

AccessionMI0015221 (change log)
DescriptionPongo pygmaeus miR-1263 stem-loop
Gene family MIPF0000687; mir-1263
Stem-loop
                      cc   c           u  aa 
5' cuaccccaaaauaugguac  ugg auacugaguau uu  u
   |||||||||||||||||||  ||| ||||||||||| ||   
3' gaugggguuuuauaccgug  acc uaugacucaua gg  a
                      au   a           c  gc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 167702614-167702697 [-]
intergenic
Database links

Mature sequence ppy-miR-1263

Accession MIMAT0016187
Sequence

13 - 

augguacccuggcauacugagu

 - 34

Get sequence
Evidence not experimental

References

1