Stem-loop sequence ppy-mir-1248

AccessionMI0015206 (change log)
DescriptionPongo pygmaeus miR-1248 stem-loop
Gene family MIPF0000622; mir-1248
Stem-loop
   --------uuuac        auaa c   g     ---aa        c          
5'              cuucuugu    g acu ugcua     auugcaga acuaggacc 
                ||||||||    | ||| |||||     |||||||| |||||||| a
3'              gaagaaca    c uga acgau     uaacguuu ugguucugu 
   acgacaaugaaaa        --ca a   g     cguaa        u          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 190576400-190576505 [+]
intergenic
Database links

Mature sequence ppy-miR-1248

Accession MIMAT0016173
Sequence

4 - 

accuucuuguauaagcacugugcuaaa

 - 30

Get sequence
Evidence not experimental

References

1