Stem-loop sequence ppy-mir-1245

AccessionMI0015203 (change log)
DescriptionPongo pygmaeus miR-1245 stem-loop
Gene family MIPF0000620; mir-1245
Stem-loop
   a       a              - -aucu   guu 
5'  uuuaugu uaggccuuuagauc c     gag   g
    ||||||| |||||||||||||| |     |||    
3'  aaauaca auccggaaaucuag g     cuc   a
   -       c              u aauuu   aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 79729596-79729666 [+]
intergenic
Database links

Mature sequence ppy-miR-1245

Accession MIMAT0016170
Sequence

46 - 

aagugaucuaaaggccuacac

 - 66

Get sequence
Evidence not experimental

References

1