Stem-loop sequence ppy-mir-1236

AccessionMI0015199 (change log)
DescriptionPongo pygmaeus miR-1236 stem-loop
Gene family MIPF0000689; mir-1236
Stem-loop
   -- u   u    -      au    auggacuggaagugggcagcauggagcu 
5'   g gag gaca ggggaa  gggg                            g
     | ||| |||| ||||||  ||||                             
3'   c cuc cugu ccccuu  cucc                            a
   ga -   u    u      --    guaauacaaccgguucgguacugcuucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr6: 32456874-32456975 [-]
intergenic
Database links

Mature sequence ppy-miR-1236

Accession MIMAT0016166
Sequence

81 - 

ccucuuccccuugucucuccag

 - 102

Get sequence
Evidence not experimental

References

1