Stem-loop sequence ppy-mir-1226

AccessionMI0015195 (change log)
DescriptionPongo pygmaeus miR-1226 stem-loop
Gene family MIPF0000444; mir-1226
Stem-loop
   gug    c       c    a      a   ----g  a 
5'    aggg augcagg cugg uggggc gcu     gg u
      |||| ||||||| |||| |||||| |||     || g
3'    uccc ugugucc gacc acuccg ugg     cc g
   -ga    u       c    -      g   gaaaa  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr3: 98728456-98728530 [-]
intergenic
Database links

Mature sequence ppy-miR-1226

Accession MIMAT0016162
Sequence

54 - 

ucaccagcccuguguucccuag

 - 75

Get sequence
Evidence not experimental

References

1