Stem-loop sequence ppy-mir-1208

AccessionMI0015192 (change log)
DescriptionPongo pygmaeus miR-1208 stem-loop
Gene family MIPF0000628; mir-1208
Stem-loop
   -     g   -aauc   gu     ca    -    cg 
5'  caccg cag     acu  ucaga  ggcg gaga  g
    ||||| |||     |||  |||||  |||| ||||   
3'  guggu guc     uga  agucu  ccgc cuuu  g
   g     -   accac   gu     -a    u    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 135928033-135928105 [+]
intergenic
Database links

Mature sequence ppy-miR-1208

Accession MIMAT0016157
Sequence

12 - 

ucacuguucagacaggcgga

 - 31

Get sequence
Evidence not experimental

References

1