Stem-loop sequence ppy-mir-1204

AccessionMI0015189 (change log)
DescriptionPongo pygmaeus miR-1204 stem-loop
Gene family MIPF0000671; mir-1204
Stem-loop
   accu  u   cug   uc    a  ug     a 
5'     cg ggc   guc  cauu uu  agaug g
       || |||   |||  |||| ||  ||||| u
3'     gc ccg   cag  gugg ag  ucuac u
   --gu  u   -ug   ga    -  gu     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 135560465-135560529 [+]
intergenic
Database links

Mature sequence ppy-miR-1204

Accession MIMAT0016153
Sequence

4 - 

ucguggccuggucuccauuau

 - 24

Get sequence
Evidence not experimental

References

1