Stem-loop sequence ppy-mir-1197

AccessionMI0015185 (change log)
DescriptionPongo pygmaeus miR-1197 stem-loop
Gene family MIPF0000126; mir-379
Stem-loop
   acuuccu      -u     ugc   u       gug g    - uuu 
5'        gguauu  gaaga   ggu gaccaug   u uacg c   a
          ||||||  |||||   ||| |||||||   | |||| |   u
3'        cuauaa  cuucu   uca cugguac   g augc g   u
   ------a      cu     ---   u       aca g    a uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102586977-102587064 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-1197
ppy-mir-379chr14: 102583478-102583544 [+]
ppy-mir-411chr14: 102584737-102584832 [+]
ppy-mir-299chr14: 102585203-102585265 [+]
ppy-mir-380chr14: 102586431-102586490 [+]
ppy-mir-1197chr14: 102586977-102587064 [+]
ppy-mir-323chr14: 102587145-102587230 [+]
ppy-mir-758chr14: 102587434-102587521 [+]
ppy-mir-329-1chr14: 102588199-102588278 [+]
ppy-mir-329-2chr14: 102588514-102588596 [+]
ppy-mir-494chr14: 102591073-102591153 [+]
ppy-mir-1193chr14: 102591485-102591597 [+]
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
Database links

Mature sequence ppy-miR-1197

Accession MIMAT0016149
Sequence

57 - 

uaggacacauggucuacuucu

 - 77

Get sequence
Evidence not experimental

References

1