Stem-loop sequence ppy-mir-1185-2

AccessionMI0015184 (change log)
DescriptionPongo pygmaeus miR-1185-2 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u       u    -     ga a              a  uga 
5'  uugguac uaaa gagag  u cccuuuguauguuc cu   u
    ||||||| |||| |||||  | |||||||||||||| ||    
3'  aacuaug guuu uucuc  a gggggacauauaag gg   u
   a       c    a     ag -              c  uaa 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102606330-102606415 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-1185-2
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
ppy-mir-487achr14: 102614611-102614690 [+]
Database links

Mature sequence ppy-miR-1185

Accession MIMAT0016148
Sequence

15 - 

agaggauacccuuuguauguu

 - 35

Get sequence
Evidence not experimental

References

1