Stem-loop sequence ppy-mir-1183

AccessionMI0015182 (change log)
DescriptionPongo pygmaeus miR-1183 stem-loop
Gene family MIPF0000668; mir-1183
Stem-loop
   au     aaa     g a -a   agaa     ga aag    ga 
5'   uauuc   ugcuc g g  cac    cauua  g   auag  g
     |||||   ||||| | |  |||    |||||  |   ||||  u
3'   guaag   acgag u c  gug    guggu  u   uguc  u
   cc     --g     g a gg   -aga     ag gga    ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 62977185-62977273 [-]
intergenic
Database links

Mature sequence ppy-miR-1183

Accession MIMAT0016147
Sequence

48 - 

cacuguaggugauggugagagugggca

 - 74

Get sequence
Evidence not experimental

References

1