Stem-loop sequence ppy-mir-1178

AccessionMI0015178 (change log)
DescriptionPongo pygmaeus miR-1178 stem-loop
Gene family MIPF0000601; mir-1178
Stem-loop
   --    g      gagga       gg ccg    c g     ca 
5'   guug cuggca     agggaag  u   gggu g cugag  u
     |||| ||||||     |||||||  |   |||| | |||||   
3'   uagu gacugu     ucccuuc  g   cucg u gacuc  g
   ug    g      -aaga       uu uca    u g     cc 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr12: 121913357-121913445 [-]
intergenic
Database links

Mature sequence ppy-miR-1178

Accession MIMAT0016143
Sequence

54 - 

uugcucacuguucuucccuag

 - 74

Get sequence
Evidence not experimental

References

1