Stem-loop sequence ppy-mir-936

AccessionMI0015171 (change log)
DescriptionPongo pygmaeus miR-936 stem-loop
Gene family MIPF0000517; mir-936
Stem-loop
   ucaa    -  u     --aa     -     aaucacagaaaucacucc 
5'     ggcc gc gggac    uagag ggagg                  a
       |||| || |||||    ||||| |||||                  g
3'     ccgg cg uccug    auuuc ucuuc                  g
   agac    u  -     gacc     a     auuccagagagucaacga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 103143697-103143794 [-]
intergenic
Database links

Mature sequence ppy-miR-936

Accession MIMAT0016136
Sequence

15 - 

acaauagagggaggaaucacag

 - 36

Get sequence
Evidence not experimental

References

1