Stem-loop sequence ppy-mir-933

AccessionMI0015169 (change log)
DescriptionPongo pygmaeus miR-933 stem-loop
Gene family MIPF0000505; mir-933
Stem-loop
      -     caguuc       -   ggg  u     u  a u 
5' acu ugggu      agagguc cuc   gu gcgcg cg g c
   ||| |||||      ||||||| |||   || ||||| || |  
3' uga accca      ucuccag ggg   cg cgugu gc c a
      c     ---ccc       a   --a  -     -  - g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr2B: 65289201-65289278 [-]
intergenic
Database links

Mature sequence ppy-miR-933

Accession MIMAT0016134
Sequence

48 - 

ugugcgcagggagaccucuccc

 - 69

Get sequence
Evidence not experimental

References

1