Stem-loop sequence ppy-mir-887

AccessionMI0015157 (change log)
DescriptionPongo pygmaeus miR-887 stem-loop
Gene family MIPF0000554; mir-887
Stem-loop
   --       u        --  -      ag    ug auu 
5'   gugcaga ccuuggga  gc ccuguu  acuc  g   u
     ||||||| ||||||||  || ||||||  ||||  |   u
3'   cacguuu ggagcccu  cg gggcaa  ugag  u   a
   ga       c        ac  c      -g    gu cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 16799560-16799638 [+]
intergenic
Database links

Mature sequence ppy-miR-887

Accession MIMAT0016122
Sequence

48 - 

gugaacgggcgccaucccgagg

 - 69

Get sequence
Evidence not experimental

References

1