Stem-loop sequence ppy-mir-875

AccessionMI0015152 (change log)
DescriptionPongo pygmaeus miR-875 stem-loop
Gene family MIPF0000424; mir-875
Stem-loop
   --      gu  uau        u  a       uucu 
5'   uuagug  ac   accucagu uu ucaggug    u
     ||||||  ||   |||||||| || |||||||     
3'   agucac  ug   uggaguca aa gguccac    a
   ca      uc  ugu        u  a       uaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 106012672-106012747 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-875
ppy-mir-875chr8: 106012672-106012747 [-]
ppy-mir-599chr8: 106012522-106012616 [-]
Database links

Mature sequence ppy-miR-875-5p

Accession MIMAT0016113
Sequence

11 - 

uauaccucaguuuuaucaggug

 - 32

Get sequence
Evidence not experimental

Mature sequence ppy-miR-875-3p

Accession MIMAT0016114
Sequence

45 - 

ccuggaaauacugagguugug

 - 65

Get sequence
Evidence not experimental

References

1