Stem-loop sequence ppy-mir-802

AccessionMI0015149 (change log)
DescriptionPongo pygmaeus miR-802 stem-loop
Gene family MIPF0000353; mir-802
Stem-loop
   ---guu      u     g c   a          a      -   cc 
5'       cuguua uugca u agu acaaagauuc uccuug ugu  a
         |||||| ||||| | ||| |||||||||| |||||| |||  u
3'       gauaau aaugu a uca uguuucuaag aggaac acg  c
   cagguc      u     g u   c          -      g   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr21: 36758495-36758588 [+]
intergenic
Database links

Mature sequence ppy-miR-802

Accession MIMAT0016110
Sequence

18 - 

caguaacaaagauucauccuugu

 - 40

Get sequence
Evidence not experimental

References

1