Stem-loop sequence ppy-mir-766

AccessionMI0015146 (change log)
DescriptionPongo pygmaeus miR-766 stem-loop
Gene family MIPF0000677; mir-766
Stem-loop
     a    cag   -cug    u       ag    aau   u     ucuu   uuu 
5' gc uccu   gac    ggcu ggguggu  gagg   ugg gcugg    uca   u
   || ||||   |||    |||| |||||||  ||||   ||| |||||    |||   g
3' cg agga   cug    ccga cccaccg  cucc   acc cgacc    agu   g
     -    -ua   uuaa    c       -a    gac   c     --uc   uua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 118586114-118586224 [-]
intergenic
Database links

Mature sequence ppy-miR-766

Accession MIMAT0016106
Sequence

65 - 

acuccagccccacagccucagc

 - 86

Get sequence
Evidence not experimental

References

1