Stem-loop sequence ppy-mir-708

AccessionMI0015140 (change log)
DescriptionPongo pygmaeus miR-708 stem-loop
Gene family MIPF0000397; mir-708
Stem-loop
   -aa        a           a     c  ggg  aa   ac 
5'    cugcccuc aggagcuuaca ucuag ug   gu  aug  u
      |||||||| ||||||||||| ||||| ||   ||  |||  u
3'    gacgggag ucuucgagugu agauc ac   ca  uac  g
   agg        a           c     a  --a  ag   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 74946498-74946585 [-]
intergenic
Database links

Mature sequence ppy-miR-708

Accession MIMAT0016100
Sequence

11 - 

aaggagcuuacaaucuagcuggg

 - 33

Get sequence
Evidence not experimental

References

1