Stem-loop sequence ppy-mir-675a

AccessionMI0015138 (change log)
DescriptionPongo pygmaeus miR-675a stem-loop
Gene family MIPF0000365; mir-675
Stem-loop
          u    u    a      cc      gacu 
5' cccaggg cugg gcgg gagggc  acagug    u
   ||||||| |||| |||| ||||||  ||||||     
3' ggguccc gacu cgcc cucccg  ugucgc    g
          c    -    a      ua      agug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr11: 1869658-1869730 [-]
intergenic
Database links

Mature sequence ppy-miR-675a

Accession MIMAT0016098
Sequence

10 - 

uggugcggagagggcccacagug

 - 32

Get sequence
Evidence not experimental

References

1