Stem-loop sequence ppy-mir-664

AccessionMI0015135 (change log)
DescriptionPongo pygmaeus miR-664 stem-loop
Gene family MIPF0000300; mir-664
Stem-loop
   ---gaa    gaaacu    a    aag   u         ac 
5'       cauu      ggcu ggga   uga uggauagaa  u
         ||||      |||| ||||   ||| |||||||||  a
3'       guaa      ccga cccu   auu acuuaucuu  u
   aaaaaa    -aacau    c    ---   u         au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 29519653-29519734 [+]
intergenic
Database links

Mature sequence ppy-miR-664

Accession MIMAT0016094
Sequence

49 - 

uauucauuuauccccagccuaca

 - 71

Get sequence
Evidence not experimental

References

1