Stem-loop sequence ppy-mir-660

AccessionMI0015133 (change log)
DescriptionPongo pygmaeus miR-660 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   ----------cu    c      -cauac    u      c    u   gaau 
5'             gcuc uucucc      ccau gcauau ggag ugu    u
               |||| ||||||      |||| |||||| |||| |||    c
3'             cgag gggagg      ggua cgugug ccuc aca    u
   gugcuacuguuc    u      acauua    -      u    c   aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 50546331-50546427 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-660
ppy-mir-500chrX: 50541281-50541364 [+]
ppy-mir-362chrX: 50541816-50541877 [+]
ppy-mir-660chrX: 50546331-50546427 [+]
ppy-mir-502chrX: 50547689-50547774 [+]
Database links

Mature sequence ppy-miR-660

Accession MIMAT0016092
Sequence

16 - 

uacccauugcauaucggaguug

 - 37

Get sequence
Evidence not experimental

References

1