Stem-loop sequence ppy-mir-654

AccessionMI0015129 (change log)
DescriptionPongo pygmaeus miR-654 stem-loop
Gene family MIPF0000409; mir-654
Stem-loop
       aagugg    a      g c     a      - -  a 
5' gggu      aaag uggugg c gcaga caugug c ug g
   ||||      |||| |||||| | ||||| |||||| | ||  
3' cccg      uuuc acuacc g cgucu guauac g gc u
       --aaga    c      a u     -      c u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 102602352-102602432 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-654
ppy-mir-543chr14: 102593436-102593513 [+]
ppy-mir-495chr14: 102595205-102595283 [+]
ppy-mir-376cchr14: 102601818-102601883 [+]
ppy-mir-376a-2chr14: 102602202-102602281 [+]
ppy-mir-654chr14: 102602352-102602432 [+]
ppy-mir-376bchr14: 102602569-102602668 [+]
ppy-mir-376a-1chr14: 102602915-102602982 [+]
ppy-mir-300chr14: 102603492-102603574 [+]
ppy-mir-1185-1chr14: 102605109-102605194 [+]
ppy-mir-1185-2chr14: 102606330-102606415 [+]
ppy-mir-381chr14: 102608058-102608132 [+]
ppy-mir-487bchr14: 102608591-102608674 [+]
ppy-mir-539chr14: 102609453-102609530 [+]
ppy-mir-889chr14: 102610033-102610111 [+]
ppy-mir-544chr14: 102610806-102610896 [+]
ppy-mir-655chr14: 102611698-102611794 [+]
Database links

Mature sequence ppy-miR-654-5p

Accession MIMAT0016087
Sequence

16 - 

uggugggccgcagaacaugugc

 - 37

Get sequence
Evidence not experimental

Mature sequence ppy-miR-654-3p

Accession MIMAT0016088
Sequence

51 - 

uaugucugcugaccaucaccuu

 - 72

Get sequence
Evidence not experimental

References

1