Stem-loop sequence ppy-mir-651

AccessionMI0015126 (change log)
DescriptionPongo pygmaeus miR-651 stem-loop
Gene family MIPF0000478; mir-651
Stem-loop
   ---------aau  a   c              ag   ga       ucaaa 
5'             cu uca ugcuuuuuaggaua  uuu  cuuuugu     u
               || ||| ||||||||||||||  |||  |||||||      
3'             ga agu acggaaaauccuau  gaa  gaaaacg     a
   uuuguguaauuu  c   a              gu   ag       uaaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 7837534-7837630 [+]
intergenic
Database links

Mature sequence ppy-miR-651

Accession MIMAT0016084
Sequence

16 - 

uuuaggauaaguuugacuuuug

 - 37

Get sequence
Evidence not experimental

References

1