Stem-loop sequence ppy-mir-650

AccessionMI0015125 (change log)
DescriptionPongo pygmaeus miR-650 stem-loop
Gene family MIPF0000457; mir-650
Stem-loop
   ----ca     ----------     cuc      c   -ucuc     a   cu 
5'       gugcu          ggggu   aggagg agc     ucggg cgu  c
         |||||          |||||   |||||| |||     ||||| |||  c
3'       cacgg          uccca   uccucc ucg     ggucc gua  a
   agugga     gacucacucc     --c      -   ucucu     g   cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr22: 17582330-17582424 [+]
intergenic
Database links

Mature sequence ppy-miR-650

Accession MIMAT0016083
Sequence

16 - 

aggaggcagcucucucgggac

 - 36

Get sequence
Evidence not experimental

References

1