Stem-loop sequence ppy-mir-633

AccessionMI0015114 (change log)
DescriptionPongo pygmaeus miR-633 stem-loop
Gene family MIPF0000546; mir-633
Stem-loop
   -aa    ucu    cuc    ucuug    c                 uaaa 
5'    ccuc   uagc   uguu     auug gguagauacuauuagcc    a
      ||||   ||||   ||||     |||| |||||||||||||||||    u
3'    ggag   guug   acaa     uaac ccaucuaugauaaucgg    g
   aua    --u    -uu    -----    a                 caga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr17: 52609225-52609322 [+]
intergenic
Database links

Mature sequence ppy-miR-633

Accession MIMAT0016072
Sequence

61 - 

cuaauaguaucuaccacaauaac

 - 83

Get sequence
Evidence not experimental

References

1