Stem-loop sequence ppy-mir-624

AccessionMI0015108 (change log)
DescriptionPongo pygmaeus miR-624 stem-loop
Gene family MIPF0000523; mir-624
Stem-loop
   -----------                                   -- ag  g 
5'            aaugcuguuucgagguaguaccaguaccuuguguu  c  ug a
              |||||||||||||||||||||||||||||||||||  |  ||  
3'            uuacgauagaguuccauuaugguuauggaacacaa  g  ac a
   gugaauccaca                                   au ga  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr14: 30634262-30634358 [-]
intergenic
Database links

Mature sequence ppy-miR-624

Accession MIMAT0016065
Sequence

54 - 

cacaagguauugguauuaccu

 - 74

Get sequence
Evidence not experimental

References

1