Stem-loop sequence ppy-mir-606

AccessionMI0015092 (change log)
DescriptionPongo pygmaeus miR-606 stem-loop
Gene family MIPF0000780; mir-606
Stem-loop
   ------------      c                 u         a    ug 
5'             uguauc uugguuuuuaguaguuu acuaugaug ggug  c
               |||||| ||||||||||||||||| ||||||||| ||||  c
3'             acauag aacuaaaaaucaucaaa ugauacuac ccac  a
   accaguccguga      a                 -         c    cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 59609201-59609296 [-]
intergenic
Database links

Mature sequence ppy-miR-606

Accession MIMAT0016048
Sequence

61 - 

aaacuacuaaaaaucaaagau

 - 81

Get sequence
Evidence not experimental

References

1