Stem-loop sequence ppy-mir-603

AccessionMI0015089 (change log)
DescriptionPongo pygmaeus miR-603 stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   gauugaugc      u    u             ug   cuuc     ua 
5'          uguugg uugg gcaaaaguaauug  gug    ccauu  a
            |||||| |||| |||||||||||||  |||    |||||  a
3'          auaauu aacc cguuuucauuaac  cac    gguaa  a
   ---------      c    u             gu   acac     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr10: 25271542-25271635 [+]
intergenic
Database links

Mature sequence ppy-miR-603

Accession MIMAT0016045
Sequence

61 - 

cacacacugcaauuacuuuugc

 - 82

Get sequence
Evidence not experimental

References

1