Stem-loop sequence ppy-mir-598

AccessionMI0015084 (change log)
DescriptionPongo pygmaeus miR-598 stem-loop
Gene family MIPF0000393; mir-598
Stem-loop
   gcuugaugaugcugcugaugcu         cc     gu  g   uggaa 
5'                       ggcggugau  cgaug  gu agc     a
                         |||||||||  |||||  || |||      
3'                       cugcuacug  gcuac  ca ucg     u
   ------gagccuacuacuacua         uu     ug  -   ugggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr8: 8862457-8862553 [+]
intergenic
Database links

Mature sequence ppy-miR-598

Accession MIMAT0016040
Sequence

61 - 

uacgucaucguugucaucguca

 - 82

Get sequence
Evidence not experimental

References

1