Stem-loop sequence ppy-mir-583

AccessionMI0015071 (change log)
DescriptionPongo pygmaeus miR-583 stem-loop
Gene family MIPF0000482; mir-583
Stem-loop
   aacucacacauuu          a             - c     
5'              accaaagagg aggucccaguacu c aggg 
                |||||||||| ||||||||||||| | ||| a
3'              ugguuucucc uccagggucauga g uucu 
   -------------          a             c a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 96770461-96770535 [+]
intergenic
Database links

Mature sequence ppy-miR-583

Accession MIMAT0016026
Sequence

16 - 

caaagaggaaggucccaguac

 - 36

Get sequence
Evidence not experimental

References

1