Stem-loop sequence ppy-mir-580

AccessionMI0015068 (change log)
DescriptionPongo pygmaeus miR-580 stem-loop
Gene family MIPF0000515; mir-580
Stem-loop
   auaa      c                                   uaa 
5'     aauuuc aauuggaaccuaaugauucaucagacucagauauu   g
       |||||| |||||||||||||||||||||||||||||||||||   u
3'     uuaaag uugaccuuggauuacuaaguagucugaguuuauga   u
   ----      a                                   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr5: 37080727-37080823 [-]
intergenic
Database links

Mature sequence ppy-miR-580

Accession MIMAT0016022
Sequence

61 - 

uugagucugaugaaucauuagg

 - 82

Get sequence
Evidence not experimental

References

1