Stem-loop sequence ppy-mir-557

AccessionMI0015051 (change log)
DescriptionPongo pygmaeus miR-557 stem-loop
Gene family MIPF0000520; mir-557
Stem-loop
   agaaugggcaaaugaacaguaaa  ug     cu       u   -   ---u   g 
5'                        uu  gaggc  ggggccc ccc ugc    gcu g
                          ||  |||||  ||||||| ||| |||    ||| a
3'                        aa  uucug  uuccggg ggg acg    uga g
   -------------agguggagga  gu     --       u   u   uuug   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 82803839-82803936 [-]
intergenic
Database links

Mature sequence ppy-miR-557

Accession MIMAT0016004
Sequence

61 - 

guuugcaugggugggccuugucu

 - 83

Get sequence
Evidence not experimental

References

1