Stem-loop sequence ppy-mir-556

AccessionMI0015050 (change log)
DescriptionPongo pygmaeus miR-556 stem-loop
Gene family MIPF0000475; mir-556
Stem-loop
   -------ga    g                c            ---  uuc 
5'          uagu auaagaaagaugagcu auuguaauauga   gc   a
            |||| |||||||||||||||| ||||||||||||   ||   u
3'          auca uauuuuuucuacucga uaacauuauacu   cg   u
   acaacuucc    g                u            uua  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 89027927-89028021 [-]
intergenic
Database links

Mature sequence ppy-miR-556-5p

Accession MIMAT0016002
Sequence

16 - 

gaugagcucauuguaauaugag

 - 37

Get sequence
Evidence not experimental

Mature sequence ppy-miR-556-3p

Accession MIMAT0016003
Sequence

55 - 

auauuacaauuagcucaucuuu

 - 76

Get sequence
Evidence not experimental

References

1