Stem-loop sequence ppy-mir-555

AccessionMI0015049 (change log)
DescriptionPongo pygmaeus miR-555 stem-loop
Gene family MIPF0000583; mir-555
Stem-loop
   -------     gaac     u   g   ac      u  ga    u  gac 
5'        ggagu    ucaga gug agc  uaccuu gu  gcag gu   c
          |||||    ||||| ||| |||  |||||| ||  |||| ||    
3'        ucuca    agucu cac ucg  auggga ca  uguc cg   c
   uaucuag     aaau     c   g   -a      -  gg    -  gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr1: 96177027-96177122 [+]
intergenic
Database links

Mature sequence ppy-miR-555

Accession MIMAT0016001
Sequence

61 - 

aggguaagcugcaccucugau

 - 81

Get sequence
Evidence not experimental

References

1