Stem-loop sequence ppy-mir-532

AccessionMI0015037 (change log)
DescriptionPongo pygmaeus miR-532 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   cgacuu    u    c  c  u      a    a   cc  uggca 
5'       gcuu cucu cu ca gccuug gugu gga  gu     u
         |||| |||| || || |||||| |||| |||  ||     c
3'       cgag gaga ga gu cggaac caca ccu  ca     u
   ----uc    c    a  c  u      c    c   cc  uuaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chrX: 50535905-50535995 [+]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-532
ppy-mir-532chrX: 50535905-50535995 [+]
ppy-mir-188chrX: 50536260-50536345 [+]
ppy-mir-500chrX: 50541281-50541364 [+]
ppy-mir-362chrX: 50541816-50541877 [+]
Database links

Mature sequence ppy-miR-532-5p

Accession MIMAT0015987
Sequence

20 - 

caugccuugaguguaggaccgu

 - 41

Get sequence
Evidence not experimental

Mature sequence ppy-miR-532-3p

Accession MIMAT0015988
Sequence

57 - 

ccucccacacccaaggcuugca

 - 78

Get sequence
Evidence not experimental

References

1